Paul WhitingtonBatch 6

Pergagrapta sp. (PERGINAE) PW107

Paul WhitingtonBatch 6
Pergagrapta sp. (PERGINAE) PW107

Workbook

Detailed description of an adult female Pergagrapta sp. collected by Jenny Emeny at her property at Cudgee, near Warrnambool, VIC.

Featured
head, antennae orange; pronotum, middle lobe of mesoscutum, scutellum (in part), wings brown; lateral lobes of mesoscutum black.
female, #PW107
female, #PW107

head, antennae orange; pronotum, middle lobe of mesoscutum, scutellum (in part), wings brown; lateral lobes of mesoscutum black.

female, #PW107
head, antennae orange; pronotum, middle lobe of mesoscutum, scutellum (in part), wings brown; lateral lobes of mesoscutum black.
female, #PW107
female, #PW107

head, antennae orange; pronotum, middle lobe of mesoscutum, scutellum (in part), wings brown; lateral lobes of mesoscutum black.

female, #PW107
head, antennae, legs orange; pronotum, mesopleura (in part), lateral side of abdomen, venter brown.
female, #PW107
female, #PW107

head, antennae, legs orange; pronotum, mesopleura (in part), lateral side of abdomen, venter brown.

female, #PW107
body length 20mm
female, #PW107
female, #PW107

body length 20mm

female, #PW107
head, antennae, legs orange; pronotum, middle lobe of mesoscutum, scutellum (in part), mesopleura (in part), wings brown; abdomen mottled orange and black with black dominant in posterior segments; hind basitarsus clearly longer than 3 following tar
female, #PW107
female, #PW107

head, antennae, legs orange; pronotum, middle lobe of mesoscutum, scutellum (in part), mesopleura (in part), wings brown; abdomen mottled orange and black with black dominant in posterior segments; hind basitarsus clearly longer than 3 following tarsal segments together.

female, #PW107
head, antennae, legs orange; mesosternum, venter of abdomen brown
female, #PW107
female, #PW107

head, antennae, legs orange; mesosternum, venter of abdomen brown

female, #PW107
vertex, genae, antennal tubercles orange; vertex uniformly densely pilose; postocellar area clearly defined laterally, U-shaped, in front raised above the level of genae; genae weakly pilose, scarcely punctured.
female, #PW107
female, #PW107

vertex, genae, antennal tubercles orange; vertex uniformly densely pilose; postocellar area clearly defined laterally, U-shaped, in front raised above the level of genae; genae weakly pilose, scarcely punctured.

female, #PW107
vertex, genae, antennal tubercles orange; vertex uniformly densely pilose; postocellar area clearly defined laterally, U-shaped, in front raised above the level of genae; genae weakly pilose, scarcely punctured.
female, #PW107
female, #PW107

vertex, genae, antennal tubercles orange; vertex uniformly densely pilose; postocellar area clearly defined laterally, U-shaped, in front raised above the level of genae; genae weakly pilose, scarcely punctured.

female, #PW107
scape, pedicel, antennal flagellum, antennal tubercles, inner orbits, genae, face, clypeus, labrum, mandibles orange (except for black tips of teeth); clypeus with emarginate apex; deep inter-antennal furrow.
female, #PW107
female, #PW107

scape, pedicel, antennal flagellum, antennal tubercles, inner orbits, genae, face, clypeus, labrum, mandibles orange (except for black tips of teeth); clypeus with emarginate apex; deep inter-antennal furrow.

female, #PW107
scape, pedicel, antennal flagellum, antennal tubercles, inner orbits, genae, face, clypeus, labrum, palpi, mandibles orange; teeth of mandibles, inter-antennal furrow black, latter deep; clypeus with emarginate apex; lower edge of labrum hairy.
female, #PW107
female, #PW107

scape, pedicel, antennal flagellum, antennal tubercles, inner orbits, genae, face, clypeus, labrum, palpi, mandibles orange; teeth of mandibles, inter-antennal furrow black, latter deep; clypeus with emarginate apex; lower edge of labrum hairy.

female, #PW107
mesoscutum densely punctate and pilose; deep furrows separating middle lobe from lateral lobes, deep medial furrow in middle lobe; middle lobe brown, lateral lobes black with brown and black lateral faces; scutellum densely punctate and pilose, brow
female, #PW107
female, #PW107

mesoscutum densely punctate and pilose; deep furrows separating middle lobe from lateral lobes, deep medial furrow in middle lobe; middle lobe brown, lateral lobes black with brown and black lateral faces; scutellum densely punctate and pilose, brown mottled with black, particularly anteriorly; long hind lobes, brown

female, #PW107
pronotum brown, densely punctate and pilose; tegula brown; metepisternum brown dorsally and black anteriorly, densely pilose and punctured; ventrally black and brown areas, glabrous, less densely punctured.
female, #PW107
female, #PW107

pronotum brown, densely punctate and pilose; tegula brown; metepisternum brown dorsally and black anteriorly, densely pilose and punctured; ventrally black and brown areas, glabrous, less densely punctured.

female, #PW107
mesoscutum and scutellum densely pilose and punctured; pronotum pilose and densely punctured; scutellum with deep medial groove, long hind lobes.
female, #PW107
female, #PW107

mesoscutum and scutellum densely pilose and punctured; pronotum pilose and densely punctured; scutellum with deep medial groove, long hind lobes.

female, #PW107
lateral view of saw. compare shape of teeth to various species in photo from Morice (1919)
female, #PW107
female, #PW107

lateral view of saw. compare shape of teeth to various species in photo from Morice (1919)

female, #PW107
detail of teeth of saw, viewed ventrally. compare to photo of saws in different species from Morice (1919)
female, #PW107
female, #PW107

detail of teeth of saw, viewed ventrally. compare to photo of saws in different species from Morice (1919)

female, #PW107
Morice saw photos.jpg
female, #PW107
female, #PW107
female, #PW107

Summary

The morphology of all body parts of this individual, including the saw, is a close match to the original description of Pergagrapta gravenhorstii by Westwood (1880) and later revisions by Morice (1919), Forsius (1929) and Benson (1939). iNaturalist observations also show a close match to its morphology.

This female differs in colouration from the descriptions in the literature and from iNaturalist observations in the following ways:

  • head, pronotum, middle lobe of mesoscutum, hind coxa and femur are brown, rather than black

  • scutellum, pleurae and posterior dorsum of abdomen are partially brown and black, rather than solid black

The hind coxa and/or femur and the genae are orange rather than black in a substantial number of iNaturalist observations, and less commonly the same applies to the post-ocellar region (this observation), the whole head apart from the post-ocellar region (this observation) or the whole head.

Therefore, the current specimen probably represents an extreme of this range of variation in body colour of Pergagrapta gravenhorstii.

I have removed a hind leg from this specimen for DNA barcoding and comparison to the sequence obtained from a Pergagrapta gravenhorstii collected by James Peake and sequenced by Erinn last year - sequence of that specimen is shown below.

>25RBP04-A3_PWL02_Pergagrapta_gravenhorstii

AACTTTATATTTTATTTTTGGGATCTGATCAGGAATAATTGGTTTATCTTTTAGAATAATTATTCGAACAGAAATAATAACTACAGGATCATTTATTGGTGATGATCAAATTTATAATGTAATTGTTACATCACATGCATTTTTAATAATTTTTTTTATAGTTATACCTATTATAATAGGAGGATTTGGTAATTGATTACTACCCCTTATATTAGGGGCCCCAGATATAGCATTTCCCCGACTTAATAACTTAAGATTTTGATTATTACCTCCATCTTTAATCTTATTAACATTTAGAAGATTTATTAATTCAGGATCAGGAACAGGATGAACTGTATACCCACCATTATCTAGAAATATTGCACATGCTGGAACATCAGTTGATATAACAATCTTCTCTCTTCATATAGCAGGAATCTCATCAATTTTAGGAGCTATCAACTTTGTATCAACAATAATTAATATACGAGCATCAGAAATAAGAATAGATAAAATACCCCTATTAGTGTGAGCAATTACTATTACAGCTATTTTACTAATTATTTCACTTCCAGTATTAGCAGGAGCTATCACCATATTATTAACTGACCGAAACTTAAATACATCTTTTTTTGACCCATCAGGAGGGGGAGACCCAATTTTATATCAACATCTTTTT

References

Benson, R.B. 1939. A revision of the Australian sawflies of the genus Perga Leach, sens. lat. (Hymenoptera, Symphyta). The Australian Zoologist 9: 324-357.

Forsius 1929a Notes on some little known Australian Tenthredinoidea. Notulae Entomologicae 9, 81-82.

Morice, F.D. 1919. Notes on Australian sawflies, especially the “Authors' Types” and other specimens in the British Museum of Natural History and the Hope Collections of the Oxford University Museum; with diagnostic synopses of the genera and species, and photographs illustrating their structural characters. Transactions of the Entomological Society of London 66: 247-333, pls XI-XV.

Westwood, J.O. 1880. A monograph of the sawflies composing the Australian genus Perga of Leach. Proceedings of the Zoological Society of London 1880: 359-379.

This is a workbook page … a part of our website where we record the observations and references used in making species identifications. The notes will not necessarily be complete. They are a record for our own use, but we are happy to share this information with others.