Pseudoperga guerinii (PERGINAE) PW042 — Life in a Southern Forest

Workbook

High resolution images of a dead male Pseudoperga guerinii (collection #PW042). Found on 11/4/2025 clutching on an Acacia leaf.

Right hind leg was removed from this specimen for DNA barcoding by Erinn Fagan-Jeffries. DNA extracted and the COI gene sequenced, sequence shown below.

AACCCTATATTTTATTTTTGGAGTATGATCTGGTATAATTGGTCTATCATTTAGAATAATTATCCGAACAGAAATAATAACCACAGGATCATTTATTGGAGATGACCAAATTTATAACGTAATTGTAACATCCCATGCATTCCTAATAATTTTTTTTATAGTTATACCGATTATAATAGGAGGATTTGGAAACTGACTTCTACCCCTTATACTAGGGGCCCCTGATATAGCATTCCCCCGACTTAATAATTTAAGATTTTGACTATTACCCCCATCTTTAATCCTACTAACATTCAGAAGATTTATTAATTCAGGGTCAGGAACAGGATGAACAGTGTATCCCCCCCTATCGAGTAATATTGCTCATGCTGGAGCATCAGTAGATATAACTATCTTTTCTCTTCATATAGCTGGAATCTCATCAATTTTAGGGGCTATTAATTTTGTTTCAACAGTTATTAACATACGAGCCTCAGAAATAAGATTAGATAAAATACCCTTATTAGTGTGAGCTGTCACTATCACTGCAATTTTATTAATCATTTCTCTCCCTGTACTAGCAGGTGCTATCACCATATTATTAACAGATCGAAACCTAAATACATCATTCTTTGACCCATCAGGCGGAGGAGACCCTATCTTATACCAACACTTATTC

This has only 88% similarity to 4 specimens of female Pseudoperga guerinii on BOLD (SICOD116-19, SICOD117-19, AUSMG457-20, AUSMG458-20) - using MUSCLE program. Photos are provided of two of those BOLD specimens and these are clearly P. guerinii rather than P. lewisii - based on all black antennae and black patches on dorsal side of abdomen. There are no BOLD records of P. lewisii for comparison.

This suggests that this specimen is unlikely to be P. guerinii as individuals of the same sawfly species typically vary in COI sequence by less than 2%. The 4 BOLD P. guerinii specimens have between 98.2% and 100% similarity in COI sequence. A BOLD male P. ferruginea specimen (HYAS1002-11) has only 86-87% similarity to those P. guerinii specimens.

On the other hand, this individual is a close match to the original description and drawing of the male of that species by Westwood (1880). See matrices for identification of Pseudoperga species and Westwood’s lithograph drawing of male here. There are several iNaturalist observations which are very similar to this specimen. One of these was seen at Mt. Buller by James Peake when many female P. guerinii were laying eggs and tending larvae on the Eucalyptus pauciflora vegetation.

The only other likely candidate species is P. belinda, but the antennae are too long for that species and the all black scutellum is also not consistent with that identity. On the other hand, Wilson (1932) reports that “males of P. guerinii have been taken in copula at Mt. St. Bernard, VIC. He states that in the mated examples the scutellum is black with apex yellow, with lateral margins yellow. This examples might be easily confused with males of P. nemoralis (belinda), except for the fact of their having seven jointed antennae.” In fact, P. belinda has only six jointed antennae. The club does appear to be two jointed but is in fact a single antennomere.

Wilson’s (1932) description of P. nemoralis male is a close match to the current specimen. Does the description of the male of P. guerinii differ from this?

This is a workbook page … a part of our website where we record the observations and references used in making species identifications. The notes will not necessarily be complete. They are a record for our own use, but we are happy to share this information with others.