Pseudoperga guerinii (PERGINAE) PW042 — Life in a Southern Forest

Workbook

High resolution images of a dead male Pseudoperga guerinii (collection #PW042). Found on 11/4/2025 clutching on an Acacia leaf.

Right hind leg was removed from this specimen for DNA barcoding by Erinn Fagan-Jeffries. DNA extracted and the COI gene sequenced, sequence shown below.

AACCCTATATTTTATTTTTGGAGTATGATCTGGTATAATTGGTCTATCATTTAGAATAATTATCCGAACAGAAATAATAACCACAGGATCATTTATTGGAGATGACCAAATTTATAACGTAATTGTAACATCCCATGCATTCCTAATAATTTTTTTTATAGTTATACCGATTATAATAGGAGGATTTGGAAACTGACTTCTACCCCTTATACTAGGGGCCCCTGATATAGCATTCCCCCGACTTAATAATTTAAGATTTTGACTATTACCCCCATCTTTAATCCTACTAACATTCAGAAGATTTATTAATTCAGGGTCAGGAACAGGATGAACAGTGTATCCCCCCCTATCGAGTAATATTGCTCATGCTGGAGCATCAGTAGATATAACTATCTTTTCTCTTCATATAGCTGGAATCTCATCAATTTTAGGGGCTATTAATTTTGTTTCAACAGTTATTAACATACGAGCCTCAGAAATAAGATTAGATAAAATACCCTTATTAGTGTGAGCTGTCACTATCACTGCAATTTTATTAATCATTTCTCTCCCTGTACTAGCAGGTGCTATCACCATATTATTAACAGATCGAAACCTAAATACATCATTCTTTGACCCATCAGGCGGAGGAGACCCTATCTTATACCAACACTTATTC

This has only 88% similarity to 4 specimens of female Pseudoperga guerinii on BOLD (SICOD116-19, SICOD117-19, AUSMG457-20, AUSMG458-20) - using MUSCLE program. Photos are provided of two of those BOLD specimens and these are clearly P. guerinii rather than P. lewisii - based on all black antennae and black patches on dorsal side of abdomen. There are no BOLD records of P. lewisii for comparison.

This suggests that this specimen is unlikely to be P. guerinii as individuals of the same sawfly species typically vary in COI sequence by less than 2%. The 4 BOLD P. guerinii specimens have between 98.2% and 100% similarity in COI sequence.

For comparison, a BOLD male P. ferruginea specimen (HYAS1002-11) has only 86-87% similarity to those P. guerinii specimens.

On the other hand, this individual is a close match to the original description and drawing of the male of that species by Westwood (1880). See matrices for identification of Pseudoperga species and Westwood’s lithograph drawing of male here. I have examined all 15 iNaturalist observations of male Pseudoperga guerinii and they are very similar to one another and my barcoded specimen, as summarised in this spreadsheet. The only difference between these is in the colour of the scutellum (either all black or black with variably sized yellow lateral areas) and the degree of infuscation of the legs. The latter is a variable feature in many sawfly species.

In addition, one of these iNat observations was made at Mt. Buller by James Peake when many female P. guerinii were laying eggs and tending larvae on the Eucalyptus pauciflora vegetation. James comments that no other Pseudoperga species were seen there at that time, supporting the conclusion that this male is indeed Pseudoperga guerinii.

What else could my #PW042 sawfly be if it isn’t Pseudoperga guerinii? There are only 3 other Eastern Australian Pseudoperga species - P. belinda, P. ventralis and P. lucida. A comparison between these species and the PW042 specimen shows that none is as good a match to the latter as the male P. guerinii.

The description of male P. ventralis by Guérin-Méneville (1835) follows:

Male: Black antennae, with a small yellow spot beneath the extremity of the last antennomere. Head black above, yellow below. Mandibles black. Labrum yellow. Clypeus yellow, blackish border. A small yellow spot at the insertion of the antennae. Thorax rough, black; following parts yellow - lateral edges of prothorax, sides of mesothorax under the lateral edges, tegulae and a small vague spot on lateral border of the scutellum. Beneath the prothorax yellow. Below the mesothorax black, with a large yellow patch on each side. Hyaline wings with reddish veins, the stigma is very dilated, as wide as the radial cell. The extremity of the wings shrinks suddenly, apparently truncated obliquely at the anterior border, from the callus?. Legs tawny yellow, with hind femora, tibia and tarsi blackish-brown distally. Abdomen tawny yellow, with bluish black dorsally, covered with a very fine grey soft shimmering down. Length 15mm.

To formally exclude the possibility that my male isn’t P. lewisii, it would be useful to get COI sequence of the female of that species. However it is unlikely that the male P. lewisii exists as no one has found them. In addition, Froggatt (1890) Proc. Linn. Soc. NSW 15: 283-288 reports:
“My specimens of larva of P. lewisii all came from Nundle. They were said to live on saplings of the "stringy bark," but fed freely on our common gum leaves. They cast their skins twice, and on 10th October instead of burrowing into the sand crawled under the bits of rotten wood on the top of the sand, and attached their cocoons to them. The first two came out on 9th December, but no more appeared until January 21st when some thirteen hatched out during the week. The male of this species is I believe unknown; all my species were females, and though there are some thirty specimens among the Macleay collection duplicates they are all of the same sex”.

So in conclusion, it is unclear why the COI sequence of my male Pseudoperga guerinii differs so much from the females of this species.

My PW042 specimen does have a close match (97.6%) to a BOLD specimen GBAH9416-14.COI-5P Pseudoperga sp. tJ2 mined from GenBank - from Malm & Nyman (2015). AMNH. The species identity of this specimen is unknown, but his result speaks against the possibility that there was a mistake in the COI sequencing of my specimen.

This is a workbook page … a part of our website where we record the observations and references used in making species identifications. The notes will not necessarily be complete. They are a record for our own use, but we are happy to share this information with others.